Skip to main content
Download PDF

MiR-223 within neutrophil axis promotes Th17 expansion by PI3K-AKT pathway in systemic lupus erythematosus

Arthritis Research & Therapy volume 27, Article number: 21 (2025) Cite this article

Abstract

Introduction

Further investigation is required to determine the etiology of systemic lupus erythematosus (SLE). The aim of this study is to assess the presence of miR-223 within neutrophils in SLE and investigate its impact on the expansion of Th17 cells.

Methods

Experiments were performed in MRL/lpr mice, which were divided into control and miR-223 knockdown (miR-223-) group. We assessed miR-223 expression within neutrophils and Th17 expansion in MRL/lpr mice and patients with SLE using RT-PCR, luciferase reporter assay, Elisa, flow cytometry analysis. Signaling pathway, RT-PCR and western blot were conducted to elucidate the mechanism by which miR-223 within neutrophils expands Th17.

Results

We initially identified miR-223 as a pivotal factor in the pathogenesis of SLE in both MRL/lpr mice and SLE patients. Subsequently, knockdown of miR-223 led to a significant reduction in Th17 expansion in MRL/lpr mice. Moreover, inhibition of miR-223 effectively attenuated the recruitment and activation of neutrophils in SLE. Furthermore, we found rb6-8c5 treatment alleviated lupus symptoms of MRL/lpr mice and reduce the level of Th17. Finally, we elucidated that neutrophils potentiate the induction of Th17 through the activation of thePI3K-AKT pathway mediated by miR-223 during SLE-associated Th17 expansion.

Conclusion

MiR-223 within neutrophil axis contributes to Th17 expansion by PI3K-AKT pathway in SLE, and miR-223 could be a therapeutic target of SLE.

Introduction

Systemic lupus erythematosus (SLE) is an autoimmune disease mediated by multiple autoantibodies directed against multiple organs [1]. Up to now, its etiology and pathogenesis have not yet been clearly clarified, both heritable and environmental factors are linked with the pathogenesis of SLE [2]. In recent years, the role of innate immune cells in the pathogenesis of SLE has been gradually recognized. Innate immune cells, including dendritic cells (DCs), macrophages, neutrophils and natural killer (NK) cells, play a crucial role in the initiation and perpetuation of the autoimmune response in SLE [3].

In particular, there is growing evidence that neutrophils play a key role in the pathogenesis of SLE [4, 5]. Neutrophils are the most abundant effector cell of the innate immune system and have been implicated as a potential source of endogenous antigenic trigger in SLE [6]. They exert immune regulation through the precisely regulation and released of diverse cytokines and chemokines that interact with different components of the immune system [7, 8]. The augmented generation of neutrophil extracellular traps (NET) prompted B cells to release autoantibodies, thereby contributing to the inflammatory response in SLE [9]. Despite the reported immunomodulatory function of neutrophils, the detailed effects in SLE have not been determined.

Micro RNAs (miRNAs) potentially play an important role in the pathogenesis of SLE with recent studies focusing on miR-223 [10,11,12]. This particular miRNA is known for its important functions in immune cell differentiation and inflammation, including macrophage polarization, neutrophil and DCs differentiation, as well as T cell-mediated inflammation [13, 14]. Additionally, miR-223 has been shown to promote the pathological differentiation of Th17 cells during autoimmunity [15]. However, the impact of miR-223 on neutrophil in SLE has been overlooked and understudied. This study aims to investigate whether miR-223 could regulate the differentiation of neutrophils in SLE and explore its impact on the upstream or downstream pathways that promote the activation of Th17 cells.

Materials and methods

Mice

24 female MRL/lpr mice and 12 BALB/c mice were obtained from Shanghai Renji Hospital, Shanghai Jiaotong University School of Medicine. Among 24 female MRL/lpr mice, 12 mice selected at random were appointed as miR-223 knockdown group (miR-223-), the rest MRL/lpr were referred as the control group. MiR-223 inhibitor was obtained from GenePharma (Shanghai, China). When the mice were raised to 10 weeks, a miR-223 inhibitor (mice, HY-RI00467) was designed (20nmol and 40nmol) to be dissolved in 200ul normal saline solution and injected into miR-223 knockdown group mice through the tail vein after centrifugation. One week later, the procedure of miR-223 injection for knockdown miR-223 group was completed. All animal experiments were ethically approved by the Animal Care and Use Committee of Nanjing Medical University (2022-SRFA-450).

SLE patients and healthy donors

12 diagnosed SLE patients were recruited from the First affiliated Hospital of Nanjing Medical University. All the patients were diagnosed as in accordance with the 2012 Systemic Lupus International Collaborating Clinic (SLICC) revised criteria for classification of SLE, and disease activity was assessed by SLE Disease Activity Index (SLEDAI) score. All the lab tests of patients were conducted before taking any medication. 12 healthy control subjects which were age and sex matched were recruited from the medical staff at the department of dermatology of Nanjing Medical University. Each subject signed an informed consent before participating in this study. This study was approved by the Human Ethics Committee of the First affiliated Hospital of Nanjing Medical University (2023-SR-287).

Detection of mouse urine protein

In the BCA protein quantitative kit, dilute the BSA standard product stock with ultra-pure water. The standard products include 2 mg/mL, 1.5 mg/mL, 1 mg/mL, 0.75 mg/mL, 0.5 mg/mL, and 0.25 mg/mL, 0.125 mg/mL, 0.025 mg/mL and 0 mg/mL respectively. Then the obtained 24-hour mouse urine was diluted 1:20 with ultra-pure water. On the 96-well plate, add 10µL standard product or sample to be tested in each hole (two double holes for each sample), then add 200µL working liquid with a platoon gun, mix well, and incubate for 30 min in a 37℃ incubator without light. Finally, the light absorption value at 562 nm was measured by enzymic labeling instrument, and the standard curve was drawn according to the light absorption value of the standard substance, and the sample concentration was calculated. The concentration of the sample is multiplied by the volume of the sample to obtain the final protein content of the mouse urine.

Isolation of CD4 + T cells

For human samples, 10mL of peripheral venous blood samples were collected from each subject and peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Hypaque density-gradient centrifugation (Eppendorf, Germany). For mouse samples, purified CD4 + T cells of kidneys and spleens were isolated by magnetic beads (Miltenyi Biotec; the purity was generally 95% at least). Other experimental techniques include Reverse-transcription PCR (RT-PCR) verification, Western blotting analysis, transfection. Cell suspension containing 1.5✖106 were seeded on a 96-well plate.

Isolation of neutrophils

Neutrophils from all the donors were isolated from fresh ethylenediaminetetraacetic acid (EDTA)-anticoagulated PB using density-gradient centrifugation on Ficoll, as previously described [16]. Fill the centrifuge tube with fresh whole anticoagulant blood. When the blood volume is less than 5mL, add 4mL of reagent A first, followed by 2mL of reagent C to create a gradient interface. Keeping the interface between the two liquid levels clear, place the blood flat on top of the separation liquid. At room temperature, apply a 1000 g horizontal rotor and centrifuge for 20 to 30 min. During centrifugation, two ring layers of milky white cells appear in the centrifuge tube; the upper layer of fine cells is the peripheral blood mononuclear cell (PBMC) layer, and the lower layer is the neutrophil layer. For magneticbead separation, neutrophils were isolated with the EasySep Human Neutrophil Enrichment Kit (StemCell Technologies) according to the manufacturer’s instructions. Purity of the sorted populations was consistently above 98% examined by flow cytometry.

Histology

Isolated kidneys and spleens (12 weeks of age) were fixed in 4% formaldehyde (Sangon Biotech, Shanghai, China) overnight, washed in phosphate-buffered saline (PBS) (Thermo Fisher Scientific, Waltham, MD, USA), embedded in paraffin, and stained with H&E, or PAS following standard procedures. Images were taken using a light microscope. Kidney sections were graded for glomerular and interstitial inflammation, and the evaluation methods of renal pathology could be found in previous studies [17]. A goat anti-mouse IgG Cy3 (BD Pharmingenâ„¢, USA) reagent was used for incubating kidney sections for 1 h in the dark, followed by mounting with Prolong gold antifade reagent (Thermo Fisher Scientific).

Reverse-transcription PCR (RT-PCR) verification

Trizol reagent (Ambion, Waltham, MA, USA) was used to extract total RNA from neutrophils, and GoScript RT System (Takara, Otsu, Japan) was used to prepare cDNA from the total RNA. The expression level of miR-223, PI3K and AKT was quantified by TB Green Premix Ex Taq II (Takara) and analysed on RT-PCR PCR system (ABI, Foster City, USA). The relative expression of these genes was presented as 2-△△Ct calculations, using GAPDH as the housekeeping gene. The primer was listed as follows: miR-233, forward: GTGCAGGGTCCGAGGT, reverse: CGGGCTGTCAGTTTGTCA; PI3K, forward: CATCACTTCCTCCTGCTCTAT, reverse: CAGTTGTTGGCAATCTTCTTC ; AKT, forward: GGACAACCGCCATCCAGACT, reverse: GCCAGGGACACCTCCATCTC; β-actin, forward: ACTCGTCATACTCCTGCT-3, reverse: GAAACTACCTTCAACTCC.

Enzyme-linked immunosorbent assay (ElISA)

Blood and kidney samples were collected for detection of IL-1β, IL-6, IL-17, IL-22, Interferon-γ (IFN-γ), tumor necrosis factorα (TNF-α), C-X-C motif ligand 1 (CXCL1), CXCL2, CCL3, dsDNA antibody and C3 concentrations by an Elisa kit according to the manufacturer’s instructions.

Flow cytometry

Cells were stained with Fixable Viability Dye eFluor 780 (eBioscience) for 10 min in PBS at RT together with an anti-FcgRII/FcgRIII antibody (clone 2.4G2, Bio X Cell). After washing, surface antigens were stained with antibodies in PBS containing 0.5% BSA for 20 min at RT in the dark.

For intracellular cytokine staining, cells were stimulated for 6 h at 37℃ with Cell Stimulation Cocktail Plus Protein Transport Inhibitors (00-4975-93,eBioscience). Neutrophils labelled as CD11b PerCP-Cyanine5.5 (BD Pharmingenâ„¢, USA) and Ly-6G-APC (BD Pharmingenâ„¢, USA), macrophages labelled as CD11b (BD Pharmingenâ„¢, USA) and CD68 (BD Pharmingenâ„¢, USA), DC labelled as CD11c (BD Pharmingenâ„¢, USA) and CD40 (BD Pharmingenâ„¢, USA) from bone marrow or peripheral blood were analyzed. Cells were washed with PBS to adjust the cell concentration FITC-CD4 (BD Pharmingenâ„¢, USA) was added to 2 × 106/mL, and the corresponding control was added to the care, and the cells were washed with 1 mL PBS and 1%PBS formaldehyde fixative at room temperature for 20 min. The negative range of fluorescence was determined by control. Lymphocyte gates were initially sampled according to the forward Angle scattering light and lateral Angle scattering light of cells. 3 × 105 cells in each sample were determined. CD4 + T cell percentage was detected in all the subjects. Analysis of flow cytometry data was carried out with FlowJo software (TreeStar, Inc., Ashland, OR, USA).

Luciferase reporter assay

Neutrophils seeded in 96-wells with wild type CCL3 and the mutant CCL3 were transfected with the reporter vector along with the wild type CCL3. 50 nm miR-223 mimic by Lipofectamine 3000 (Invitrogen, Boston, MA) was also transfected into cells. By using Dual Luciferase Assay Systemic (Promega, Madison, WI, USA), luciferase activity was detected.

Neutrophil depletion in vivo

All the MRL/lpr mice were injected with 300 g/200L rb6-8c5 mAb (ABCAM, England) on days 1, 4, 5, 6 [18].

Neutrophil and CD4+ T cell co-cultured in vitro

From the peripheral blood and bone marrow of control and miR-223 knockdown mice, neutrophils were isolated. Purified neutrophils were incubated for 1 h at 37℃ in RPMI 1640 containing 10% FBS, in 96-well plates. A 96-well flat-bottom plate (Thermo Scientific) was used to culture neutrophils with CD4+T cells isolated from MRL/LPR mice and patients with SLE for 18–72 h with anti-CD3 (10 ug/ml, BD) and anti-CD28 (2 ug/mL, BD) bound to the plate. Supernatants were collected and analyzed by ELISA, and cells were analyzed by flow cytometry for neutrophil activation markers.

RNA sequencing (RNA-seq)

Neutrophils from 3 healthy controls, and were cultured in the presence of miR-223 mimic (n = 3) or inhibitor (n = 3) for 72 h. Three sets of paired samples were collected for RNA sequencing.

Western blotting (WB) analysis

As for protein expression, the samples, including neutrophils and CD4 + T cells, spleens of BALB/c mice, MRL/lpr and MRL/lpr miR-223 inhibitor group were lysed with RIPA buffer (Invitrogen, Carlsbad, CA, USA), and amounts of protein (20 mg) of cells were dissolved in NuPage LDS Sample Buffer (Invitrogen, Carlsbad, CA, USA). Protein concentrations were assessed by Protin Assay Kit (Thermo Fisher Scientific, Rockford, IL, USA). The proteins were transferred onto Polyvinylidene Fluoride membranes (Invitrogen, Carlsbad, CA, USA). Signals were detected by using the ChemiLucent ECL Detection system (Millipore) and quantitated data were analysed by Image Lab software (Bio-Rad). PI3K p85α (1:1000, Abcam; cat. 148 no. ab191606), p-AKT Ser473 (1:1000, Abcam; cat. no. ab18206), AKT (1:1000, 149 Abcam; cat. no. ab8805), LY294002 (1:1000, MCE; no. 154447), β-actin (1:1000, Abcam) were used.

Data analysis

Data were analyzed using SAS version9.0 (SAS Software, Cary, USA). Student’s unpaired t-test was used to detect differences between groups. Spearman’s rank test was used for correlation studies. P < 0.05 was considered as significant results.

Result

MiR-223 is a key factor of SLE in MRL/lpr mice

MiR-223 was upregulated in neutrophils of MRL/lpr mice compared to BALB/c mice, and miR-223 expression decreased significantly in MRL/lpr mice after knockdown miR-223 (20nmol with an inhibitory efficiency > 60% and 40nmol with an inhibitory efficiency > 80%) (Fig. 1A). As a lupus mouse model, MRL/lpr mice exhibited increased levels of proteinuria and dsDNA antibody, as well as a decreased level of C3. We discovered that inhibiting miR-223 could alleviate lupus symptoms in these mice. Following treatment with a miR-223 inhibitor, there was a noticeable decrease in proteinuria (Fig. 1B) and dsDNA antibody levels (Fig. 1C) compared to MRL/lpr mice (control). However, the level of C3 significantly increased after miR-223 inhibitor treatment (Fig. 1D). Interestingly, there was no significant difference between 20nmol and 40nmol miR-223 inhibitor treatment in these symptoms. The kidneys are often affected in MRL/lpr mice, and HE staining showed prominent glomerular inflammation with higher glomerular scores in MRL/lpr mice than in miR-223 knockdown mice but there was no significant difference, however, interstitial inflammation was similarly observed between the two groups (Fig. 1E), and IgG deposition in kidneys of miR-223 knockdown mice had an obvious remission (Fig. 1F). Furthermore, MRL/lpr mice with miR-223 over-expression had shorter lifespans compared to miR-223 knockdown mice (Fig. 1G). We also found the percentage of CD4 + T cells producing IL-17 A of the spleens was up-regulated in MRL/lpr mice compared to BALB/c mice, but miR-223 inhibitor could reserve this trend (Fig. 1H). These data indicated the absence of miR-223 was a protective factor of SLE in the context of MRL/lpr mice.

Fig. 1
figure 1

MiR-223 is a key factor of SLE in MRL/lpr mice. (A) MiR-223 was upregulated in neutrophils of MRL/lpr mice (miR-223) (n = 12) compared to BALB/c mice (n = 12), and miR-223 expression decreased significantly in MRL/lpr mice after treatment with 20nmol (n = 6) and 40nmol (n = 6) miR-223 inhibitor. MRL/lpr mice in miR-223 knockdown group showed decreased levels of proteinuria (B) and dsDNA antibody (C) and increased level of C3 (D). HE staining (E) showed prominent glomerular inflammation with higher glomerular scores in MRL/lpr mice than in miR-223 knockdown mice, interstitial inflammation was similarly observed between the two groups. IgG deposition in renal had an obvious remission after miR-223 inhibitor treatment (F). The MRL/lpr mice with miR-223 knockdown (20nmol) experienced longer lives (G). The percentage of CD4+T cells producing IL-17 A of the spleens in the spleens of BALB/c mice, MRL/lpr and MRL/lpr miR-223 inhibitor group (H). Bars indicate *p < 0.05 analyzed by Student’s unpaired t-test

Full size image

Potential clinical value of miR-223 in patients with SLE

MiR-223 was found to be up-regulated in neutrophils of patient with SLE compared to healthy controls (p < 0.05) (Fig. 2A). To further evaluate the potential clinical value of miR-223, the expression of miR-223 in SLE patients with or without skin involvement, arthritis, lupus nephritis, leukopenia, anti-dsDNA (+), anti-Sm (+), C3 or C4 deficiency was compared. Main clinical and lab parameters of the patients were displayed in Table 1. The results depicted in Fig. 2 demonstrate that miR-223 expression was significant higher in patients with lupus nephritis and those who tested positive for anti-dsDNA, anti-Sm antibodies than in patients without those symptoms (all p < 0.05). Furthermore, miR-223 expression showed a positive correlation with SLEDAI (p < 0.05) (Fig. 2H), as well as a negative correlation with the levels of C3 and C4 (both p < 0.05) (Fig. 2I and J). These findings collectively suggested that miR-223 could serve as a potential biomarker for patients with SLE.

Fig. 2
figure 2

Correlation between expression of miR-223 and clinical and lab parameters of patients with SLE (*p < 0.05, NS means none sense). (A) MiR-223 was up-regulated in neutrophils of patients with SLE (n = 12) compared to healthy controls (n = 12). Expression of miR-223 in SLE patients with or without skin involvement (B), arthritis (C), lupus nephritis (D), leukopenia (E), anti-dsDNA (+) (F), anti-Sm (+) (G) were compared. MiR-223 expression had a positive correlation with SLEDAI (p < 0.05) (H), and negative correlation with the levels of C3 and C4 (both p < 0.05) (I and J)

Full size image
Table 1 Main clinical and lab parameters of these subjects
Full size table

MiR-223 promotes Th17 expansion in SLE

To assess the potential impact of miR-223 on Th17 in SLE, a miR-223 inhibitor was transfected into neutrophils cocultured with CD4+ T cells from SLE patients, resulting in an 80% transfection efficiency (Fig. 3A). Subsequently, there was a notable decrease in the levels of IL-6 and IL-17 A in SLE patients (Fig. 3B). Furthermore, a significant reduction in the percentage of CD4+T cells producing Th17-associated cytokines (IL-17 A and IL-22) in SLE patients was observed following miR-223 knockdown in SLE patients, while the percentage of CD4+T cells producing Th1-associated cytokines (IFN-γ and TNF-α) remained unchanged (Fig. 3C and D). Notably, the kidneys of MRL/lpr mice exhibited a significant elevation in IL-17 A levels compared to BALB/c mice, which could be reversed by the administration of a 40nmol miR-223 inhibitor (Fig. 3E). Additionally, a decrease in the percentage and number of CD4+ T cells producing IL-17 A and IL-22 was evident in the kidneys of MRL/lpr mice after miR-223 inhibitor treatment (Fig. 3F).

Fig. 3
figure 3

MiR-223 promotes Th17 expansion in SLE. (A) Levels of IL-6 and IL-17 A in plasma had a marked decline after miR-223 inhibitor treatment (n = 6). (B) Percentage of CD4+ T cells which produce IL-17 A and IL-22 decreased significantly in miR-223- group (n = 6), levels of Th1 associated cytokines (IFN-γ and TNF-α) had no detectable changes. (C) Representative flow plots of percentage of CD4+ T cells producing IL-17 A and IL-22 and Th1 associated cytokines. (D) In the kidneys of MRL/lpr mice, level of IL-17 A elevated significantly compared to BALB/c mice (n = 6), whereas mi-223 inhibitor could reverse this trend (n = 6). (E) Percentage and number of CD4+ T cells producing IL-17 A and IL-22 declined evidently in the kidneys of miR-223- group (n = 6). Bars indicate *p < 0.05 analyzed by Student’s unpaired t-test

Full size image

MiR-223 inhibitor reduces the recruitment and activation of neutrophils in SLE

MiR-223 has been demonstrated to be a key regulator in the biological and immunological function of neutrophils, macrophages and DCs, and it has a close relevance to myeloid cell biology. The reduced myeloid cellularity observed in MRL/lpr mice following miR-223 knockdown (Fig. 4A) may be attributed to a decrease in the proportion of neutrophils, while no significant alteration was noted in the proportions of macrophages and DCs (Fig. 4B). Similarly, a decrease in the percentage of neutrophils was observed in the peripheral blood of MRL/lpr mice, with no significant change in the proportions of macrophages and DCs (Fig. 4C and D). Importantly, the concentrations of CXCL1, CXCL2, and CCL3, which serve as chemoattractants for neutrophils, exhibited a substantial decrease from patients with SLE who were transfected with the miR-223 inhibitor (Fig. 4E). Furthermore, we studied the target of miR-223 to explore potential regulatory mechanisms and CCL3 was identified as a potential target since it has complementary sequences with miR-223 based on miRNA target analysis (Fig. 4F). This binding was verified using luciferase reporter assays, when transfected with miR-223 mimic, luciferase activity of wt 3’LTR of CCL3 reporters was inhibited, however mut binding remained unaffected. These results indicated that miR-223 directly targets CCL3. The mean fluorescence intensity of CD62L and CD63, activation markers of neutrophil from patients with SLE, quantified by flow cytometry both decreased in miR-223- group (Fig. 4G). These data suggest that inhibition of miR-223 reduces the recruitment and activation of neutrophils in SLE.

Fig. 4
figure 4

MiR-223 inhibitor reduces the recruitment and activation of neutrophils in SLE. (A) Decreased myeloid cellularity in MRL/lpr mice after knockdown miR-223 (n = 6); (B) decreased percentage of neutrophils in bone marrow, whereas no significant change was observed in the percentage of macrophages and DCs (n = 6). (C) Decreased percentage of neutrophils was evident in peripheral blood of mice but there was no significant change of the percentage of macrophages and DCs (n = 6). (D) Representative flow plots of percentage of neutrophils, macrophages and DCs in bone marrow and peripheral blood. (E) Levels of CXCL1, CXCL2 and CCL3 demonstrated a profound decrease in the neutrophils from patients with SLE followed by transfected with the miR-223 inhibitor (n = 6). (F) MiR-223 and CCL3 have complementary sequences based on miRNA target analysis. This binding was verified by luciferase reporter assays, and miR-223 mimic inhibited luciferase activity of wt 3’LTR of CCL3 reporters, while mut binding was unaffected. (G) The mean fluorescence intensity of CD62L and CD63 quantified by flow cytometry both decreased in miR-223- group (n = 6). Bars indicate *p < 0.05 analyzed by Student’s unpaired t-test

Full size image

Neutrophils potentiate the induction of Th17 in SLE

Neutrophils infiltration is a hallmark of lupus, we firstly removed of neutrophils via rb6-8c5 mAb, our own data have confirmed > 70% reduction in circulating neutrophils (Fig. 5A). Then the neutropenia caused by rb6-8c5, could relief the symptoms of MRL/lpr mice (Fig. 5B). Importantly, rb6-8c5 could also decrease percentage of Th17 cells in peripheral blood of MRL/lpr mice, but Th1 cells responses remained unaltered (Fig. 5C). Next, neutrophils were cocultured with CD4+T cells from patients with SLE, and the percentage of CD4+T cells producing IL-17 A was elevated significantly compared to percentage of CD4+T cells producing Th1 associated cytokines (Fig. 5D). These findings collectively indicated neutrophils potentiate the induction of Th17 cells in SLE.

Fig. 5
figure 5

Neutrophils potentiate the induction of Th17 cells. (A) Percentage of neutrophils after rb6-8c5 mAb treatment, and rb6-8c5 could relief the symptoms of MRL/lpr mice (n = 6). (B) (C) The removal of neutrophils could also decrease percentage of Th17 cells in peripheral blood, but Th1 cells responses were unaltered (n = 6). (D). Neutrophils were cocultured with CD4+T cells from SLE patients, the percentage of CD4+T cells producing IL-17 A elevated significantly compared to percentage of CD4+T cells producing Th1 associated cytokines from SLE patients (n = 6). Bars indicate *p < 0.05, **p < 0.01 analyzed by Student’s unpaired t-test

Full size image

MiR-223 within neutrophils axis expands Th17 by PI3K-AKT pathway

In previous experiments, we demonstrated that inhibition of miR-223 reduced recruitment and activation of neutrophils, which are necessary for the induction of Th17 cells. Therefore, it is important to investigate whether miR-223/neutrophils axis can directly regulate the expansion of Th17 cells expansion in subsequent experiments. Initially, neutrophils isolated from patients with SLE and health controls (HC) were co-cultured with CD4+T cells from SLE patients. After 72 h of co-culture, there was a significant increase in the number of CD4+T cells in both groups (Fig. 6A), while the number of neutrophils decreased significantly (Fig. 6B). This decrease was more pronounced in HC (Fig. 6B). Additionally, the biomarkers associated with neutrophils also decreased significantly in both groups after 72 h of co-culture (Fig. 6C). Furthermore, there was an increased production of IL-17 A by CD4+T cells in both groups, with a more pronounced increase observed in patients with SLE (Fig. 6D). These findings collectively suggest that miR-223 within neutrophils axis regulates expansion of Th17 cells.

Fig. 6
figure 6

MiR-223 within neutrophils axis expands Th17 cells. Neutrophils purified from SLE patients (n = 3) and health controls (HC) (n = 3) were cocultured with CD4+T cells from SLE patients, the number of CD4+T cells elevated significantly in both two groups at 72-hour coculture (A), but the number of neutrophils decreased significantly, and the downward trend of neutrophils in miR-223 knockdown MRL/lpr mice was more pronounced (B). Biomarkers of neutrophils (CD11b+Ly6G+) all decreased significantly in both two groups at 72-hour coculture (C). IL-17 A production by CD4+T cells measured in culture supernatants was also increased in both two groups, and the upward trend in SLE patients was more obvious compared to HC (D). (E). Bubble diagram of the top 20 significant enrichment terms of genomes pathway analysis, bioinformatic analysis was performed using the OECloud tools. Enrichment of the PI3K-AKT signaling pathway is shown. (F). MiR-223 contribute to the expression of PI3K, AKT and p-AKT in healthy controls (n = 6). (G). PI3K and AKT expression in the spleens of BALB/c mice (n = 6), MRL/lpr (n = 6) and MRL/lpr miR-223 inhibitor group (n = 6). (H). Downregulation of PI3K inhibit the percentage of CD4+ T cells producing IL-17 A and the level of IL-17 A. Bars indicate *p < 0.05, **p < 0.01 analyzed by Student’s unpaired t-test

Full size image

To investigate the mechanism by which miR-223 within neutrophils expands Th17, we purified neutrophils from HC and cultured them with miR-223 mimic or inhibitor for 72 h. Pathway analysis revealed enrichment of the PI3K-AKT signaling pathway (Fig. 6E). To demonstrate the role of PI3K-AKT signaling pathway in Th17 expansion promoted by miR-223, we treated neutrophils and CD4+T cells from HC with 50nM and 100nM miR-223 mimic. The results showed that upregulation of miR-223 contribute to the expression of PI3K and AKT (Fig. 6F). We next examined PI3K and AKT expression in the spleens of BALB/c mice, MRL/lpr and MRL/lpr treated with a miR-223 inhibitor, and we found PI3K and AKT expression in MRL/lpr had upregulated levels compared to BALB/c mice, however, treating with a miR-223 inhibitor reserved this trend (Fig. 6G). To assess the downstream effects on Th17 expansion, we treated neutrophils and CD4+T cells from patients with LY294002, a specific inhibitor for PI3K, and the results showed that downregulation of PI3K inhibit the percentage of CD4+ T cells producing IL-17 A and level of IL-17 A in SLE patients (Fig. 6H). These results suggest that miR-223 within neutrophils axis expands Th17 by activating the PI3K-AKT pathway.

Discussion

Although the role of miRNAs in the development of SLE has been extensively discussed, the immune events involving neutrophils in the pathogenesis of SLE remain relatively unknown. In this study, we discovered a new mechanism of miRNA regulation within neutrophils that contributes to the expansion of Th17 in SLE. We also investigated the role of miR-223 in the development of SLE using the MRL/lpr mice model and hypothesized that miR-223 would play a pathogenic role in SLE through the recruitment of neutrophils, this would in turn lead to enhanced the potentiation the induction of Th17 cells.

MiR-223 has been identified as an immune regulator in various inflammatory diseases, including adult-onst Still’s disease (AOSD) [19] and rheumatoid arthritis (RA) [14, 15, 20]. Our study further supported this idea by demonstrating that MRL/lpr mice lacking miR-223 exhibited less severe symptoms of SLE, indicating a potential association between miR-223 and the severity of SLE. A previous report has shown that deletion of miR-223 exacerbates lupus nephritis by regulating S1pr1 in Fas (lpr/lpr) mice [21]. We believe there are several reasons for this contradiction: first, both studies have small sample sizes, larger samples will be needed in the future. Second, we observed similiar interstitial inflammation between the two groups, consistent with previous research. Although we found prominent glomerular inflammation with higher scores, there was no significant difference between two groups. As we know, AOSD, a systemic autoinflammatory disease with neutrophilic leukocytosis, shared similar pathogenesis with SLE [22]. Importantly, Tsai-Ling Liao demonstrated upregulated expression of miR-223 in neutrophils in AOSD and its positive correlation with disease activity scores [19], which aligns with our findings that miR-223 might be a potential pathogenic agent in autoinflammatory diseases.

Our findings suggest that miR-223 promotes the expansion of Th17 cells, a significant subset of T helper cells involved in autoimmunity, particularly in the IL-23/Th17 axis implicated in autoimmune diseases such as RA and SLE [23,24,25]. Further investigation into the upstream signaling pathway regulating the pathogenic Th17 response is warranted. Previous research has shown that partial deletion of the transcription factor friend leukemia integration (FLI-1) significantly impacts on IL-17 A expression and renal histopathology in the MRL/lpr mouse [26], and our discovery that miR-223 directly targets CCL3 aligns with this. Other studies have reported that miRNAs regulated the FLI-1 expression [27, 28], indicating that miRNA can be considered as an upstream regulator of this transcription factor. These findings provide additional support for our results from another perspective.

Currently, it has been established that miR-223 plays a crucial role in cell differentiation and immune modulation [15]. Given these findings, it was not unexpected that miR-223 could potentially contribute to the development of SLE by recruitment and activation of neutrophils. This also confirms our results that miR-223 inhibitor reduces the recruitment of neutrophils in lupus, but we did not observe any difference in macrophage and DC after miR-223 inhibitor treatment. As SLE is generally associated with immune tolerance loss and autoreactive T cells, we found that MRL/lpr mice knockdown for miR-223 had less neutrophil recruitment, indicating that miR-223 negatively regulates neutrophils, which coincides with other research that miR-223 serves as a regulator of innate immunity, especially differentiation of neutrophil [15, 29]. Inflammation in SLE may be aggravated by the increased death of neutrophils and disturbances of apoptotic cell clearance. Our results also suggest that miR-223 might be a negative feedback mechanism controlling innate immune responses of SLE.

In this study, we found that rb6-8c5, the neutrophil-depleting antibody, could alleviate lupus symptoms of MRL/lpr mice. Rb6-8c5 was found to have the capability of reducing the level of Th17, while having no impact on the expression of Th1. Therefore, it is not surprising that neutrophils were essential for inducting Th17 cells in lupus mice since neutrophils are closely associated with Th17-mediated immune diseases such as psoriasis and RA [30,31,32]. These findings suggest that SLE may share common therapeutic targets with psoriasis and RA, revealing that an IL-17 A inhibitor could be a potential therapeutic target for treating SLE. Importantly, conventional perspective supports the significant role played by Th17 cells in mobilization recruitment and activation of neutrophils [33]. Moreover, IL-17 is known being one important effector of neutrophils [34, 35], and our findings novel evidence supporting an interdependence between neutrophils and Th17, their cross talk might contribute to the development process involved in SLE.

The PI3K-AKT pathway is a highly active pathway involved in regulating various biological processes, such as proliferation, apoptosis and cell cycle progression [36]. PI3K acts as a key signaling molecule that can modulate multiple cellular processes, with Akt functioning as a downstream effector of PI3K. Activation of PI3K often results in the generation of p‑Akt [37]. A previous study demonstrated that B cells induce prolonged phosphorylation of Akt, which plays a crucial role in the regulation of glucose metabolism and cell cycle progression in MRL/lpr mice [38]. We investigated alterations in the PI3K-AKT pathway following miR-223 intervention by RNA-seq and western blot experiments. Previous research also highlighted the significant involvement of the PI3K-AKT pathway in the pathogenesis of SLE [39,40,41].

The novelty of these findings lies in the identification of miR-223 as the upstream regulator of Th17 within neutrophils, with significant implications for understanding the neutrophil/Th17 responses in SLE. It is noteworthy that miR-223 serves as the upstream determinant governing IL-17 A production in T cells under neutrophil stimulation. However, it is important to acknowledge certain limitations of this study. First, we only focus on PI3K-AKT pathway, the downstream factors of this pathway whether would be regulated by miR-223/neutrophil/Th17 axis needs future investigation. Furthermore, while MRL/MpJ mice are commonly used as controls for MRL/lpr mice, we used BALB/c mice instead in this research.

In conclusion, the findings of this study provide evidence in support of our hypothesis that miR-223 may play a role in the regulation of neutrophil recruitment and activation, thereby influencing the expansion of Th17 cells by activating PI3K-AKT pathway.

Data availability

All the data could be obtained by corresponding author with reasonable request.

References

  1. Jin H, Zhou S, Yu Y et al. Panoramic view of clinical features of lupus erythematosus: a cross-sectional multicentre study from China. Lupus Sci Med 2023;10(1).

  2. Marmont AM. Autoimmunity, immune complexes, DNA, and SLE. Lancet. 1980;1(8177):1088.

    Article  CAS  PubMed  Google Scholar 

  3. Herrada AA, Escobedo N, Iruretagoyena M, et al. Innate Immune cells’ contribution to systemic Lupus Erythematosus. Front Immunol. 2019;10:772.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Antiochos B, Trejo-Zambrano D, Fenaroli P et al. The DNA sensors AIM2 and IFI16 are SLE autoantigens that bind neutrophil extracellular traps. Elife 2022;11.

  5. Wang T, Vasconcellos A, Marken J, Skopelja-Gardner S, Lood C, Giltiay NV. Immune complex-driven neutrophil activation and BAFF release: a link to B cell responses in SLE. Lupus Sci Med 2022;9(1).

  6. Matta B, Barnes BJ. Coordination between innate immune cells, type I IFNs and IRF5 drives SLE pathogenesis. Cytokine. 2020;132:154731.

    Article  CAS  PubMed  Google Scholar 

  7. Martinez-Sanz P, Laurent ARG, Slot E, et al. Humanized MISTRG as a preclinical in vivo model to study human neutrophil-mediated immune processes. Front Immunol. 2023;14:1105103.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Shafqat A, Khan JA, Alkachem AY et al. How Neutrophils Shape the Immune Response: Reassessing Their Multifaceted Role in Health and Disease. Int J Mol Sci. 2023;24(24).

  9. Jiang X, Xiao X, Li H, et al. Oxidized galectin-1 in SLE fails to bind the inhibitory receptor VSTM1 and increases reactive oxygen species levels in neutrophils. Cell Mol Immunol. 2023;20(11):1339–51.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Huang Y, Xue Q, Cheng C, et al. Circular RNA in autoimmune diseases: special emphasis on regulation mechanism in RA and SLE. J Pharm Pharmacol. 2023;75(3):370–84.

    Article  PubMed  Google Scholar 

  11. Salehi A, Nasrollahzadeh Sabet M, Esmaeilzadeh E, Mousavi M, Karimi J, Pakzad B. Impact of miRNA-binding site polymorphisms in STAT3 gene on occurrence and clinical characteristics of systemic lupus erythematosus. Lupus. 2022;31(3):338–46.

    Article  CAS  PubMed  Google Scholar 

  12. Luo B, Zhou K, Liufu Y, Huang X, Zeng H, Zhang Z. Novel insight into miRNA biology and its role in the pathogenesis of systemic lupus erythematosus. Front Immunol. 2022;13:1059887.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Liu W, Zhou N, Liu Y, et al. Mesenchymal stem cell exosome-derived miR-223 alleviates acute graft-versus-host disease via reducing the migration of donor T cells. Stem Cell Res Ther. 2021;12(1):153.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Huang Y, Lu D, Ma W, et al. miR-223 in exosomes from bone marrow mesenchymal stem cells ameliorates rheumatoid arthritis via downregulation of NLRP3 expression in macrophages. Mol Immunol. 2022;143:68–76.

    Article  CAS  PubMed  Google Scholar 

  15. Jiao P, Wang XP, Luoreng ZM, et al. miR-223: an Effective Regulator of Immune Cell differentiation and inflammation. Int J Biol Sci. 2021;17(9):2308–22.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Marini O, Costa S, Bevilacqua D, et al. Mature CD10(+) and immature CD10(-) neutrophils present in G-CSF-treated donors display opposite effects on T cells. Blood. 2017;129(10):1343–56.

    Article  CAS  PubMed  Google Scholar 

  17. Sato S, Zhang XK, Matsuoka N et al. Transcription factor Fli-1 impacts the expression of CXCL13 and regulates immune cell infiltration into the kidney in MRL/lpr mouse. Lupus Sci Med 2023;10(1).

  18. Pollenus E, Malengier-Devlies B, Vandermosten L, et al. Limitations of neutrophil depletion by anti-Ly6G antibodies in two heterogenic immunological models. Immunol Lett. 2019;212:30–6.

    Article  CAS  PubMed  Google Scholar 

  19. Liao TL, Chen YM, Tang KT, Chen PK, Liu HJ, Chen DY. MicroRNA-223 inhibits neutrophil extracellular traps formation through regulating calcium influx and small extracellular vesicles transmission. Sci Rep. 2021;11(1):15676.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Dunaeva M, Blom J, Thurlings R, Pruijn GJM. Circulating serum mir-223-3p and mir-16-5p as possible biomarkers of early rheumatoid arthritis. Clin Exp Immunol. 2018;193(3):376–85.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Hiramatsu-Asano S, Sunahori-Watanabe K, Zeggar S, et al. Deletion of Mir223 exacerbates Lupus Nephritis by Targeting S1pr1 in Fas(lpr/lpr) mice. Front Immunol. 2020;11:616141.

    Article  CAS  PubMed  Google Scholar 

  22. Dong Y, Wang T, Wu H. Heterogeneity of macrophage activation syndrome and treatment progression. Front Immunol. 2024;15:1389710.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Yago T, Nanke Y, Kawamoto M, Kobashigawa T, Yamanaka H, Kotake S. IL-23 and Th17 disease in inflammatory arthritis. J Clin Med 2017;6(9).

  24. Bogunia-Kubik K, Swierkot J, Malak A, et al. IL-17A, IL-17F and IL-23R gene polymorphisms in Polish patients with rheumatoid arthritis. Arch Immunol Ther Exp (Warsz). 2015;63(3):215–21.

    Article  CAS  PubMed  Google Scholar 

  25. Larosa M, Zen M, Gatto M, et al. IL-12 and IL-23/Th17 axis in systemic lupus erythematosus. Exp Biol Med (Maywood). 2019;244(1):42–51.

    Article  CAS  PubMed  Google Scholar 

  26. Sato S, Zhang XK, Temmoku J et al. Ets family transcription factor Fli-1 promotes leukocyte recruitment and production of IL-17A in the MRL/Lpr Mouse Model of Lupus Nephritis. Cells 2020;9(3).

  27. Salmeron-Barcenas EG, Mendoza-Catalan MA, Ramirez-Bautista AU et al. Identification of Mir-182-3p/FLI-1 Axis as a Key Signaling in Immune Response in Cervical Cancer: a Comprehensive Bioinformatic Analysis. Int J Mol Sci 2023;24(7).

  28. Wang H, Lin X, Liu E, Jian Z, Ou Y. MicroRNA-33b regulates hepatocellular carcinoma cell proliferation, apoptosis, and mobility via targeting Fli-1-mediated Notch1 pathway. J Cell Physiol. 2020;235(10):7635–44.

    Article  CAS  PubMed  Google Scholar 

  29. Yuan S, Wu Q, Wang Z, et al. miR-223: an Immune Regulator in Infectious disorders. Front Immunol. 2021;12:781815.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Fries A, Saidoune F, Kuonen F, et al. Differentiation of IL-26(+) T(H)17 intermediates into IL-17A producers via epithelial crosstalk in psoriasis. Nat Commun. 2023;14(1):3878.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Su R, Li B, Wu R, et al. Stratified distribution of Th17 and Treg cells in patients with multi-stage rheumatoid arthritis. Arthritis Res Ther. 2023;25(1):55.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Katayama H. Development of psoriasis by continuous neutrophil infiltration into the epidermis. Exp Dermatol. 2018;27(10):1084–91.

    Article  CAS  PubMed  Google Scholar 

  33. Reich K, Papp KA, Matheson RT, et al. Evidence that a neutrophil-keratinocyte crosstalk is an early target of IL-17A inhibition in psoriasis. Exp Dermatol. 2015;24(7):529–35.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Chowdhury K, Kumar U, Das S, et al. Synovial IL-9 facilitates neutrophil survival, function and differentiation of Th17 cells in rheumatoid arthritis. Arthritis Res Ther. 2018;20(1):18.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Cascao R, Moura RA, Perpetuo I, et al. Identification of a cytokine network sustaining neutrophil and Th17 activation in untreated early rheumatoid arthritis. Arthritis Res Ther. 2010;12(5):R196.

    Article  PubMed  PubMed Central  Google Scholar 

  36. Besliu AN, Pistol G, Marica CM, et al. PI3K/Akt signaling in peripheral T lymphocytes from systemic lupus erythematosus patients. Roum Arch Microbiol Immunol. 2009;68(2):69–79.

    CAS  PubMed  Google Scholar 

  37. Ge F, Wang F, Yan X, Li Z, Wang X. Association of BAFF with PI3K/Akt/mTOR signaling in lupus nephritis. Mol Med Rep. 2017;16(5):5793–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Ji LN, Wu S, Fu DQ, et al. Jieduquyuziyin prescription alleviates hepatic gluconeogenesis via PI3K/Akt/PGC-1alpha pathway in glucocorticoid-induced MRL/lpr mice. J Ethnopharmacol. 2022;284:114815.

    Article  CAS  PubMed  Google Scholar 

  39. Wang J, Xie L, Wang S, Lin J, Liang J, Xu J. Azithromycin promotes alternatively activated macrophage phenotype in systematic lupus erythematosus via PI3K/Akt signaling pathway. Cell Death Dis. 2018;9(11):1080.

    Article  PubMed  PubMed Central  Google Scholar 

  40. Zhao C, Gu Y, Chen L, Su X. Upregulation of FoxO3a expression through PI3K/Akt pathway attenuates the progression of lupus nephritis in MRL/lpr mice. Int Immunopharmacol. 2020;89(Pt A):107027.

    Article  CAS  PubMed  Google Scholar 

  41. Yang H, Zhang H, Tian L et al. Curcumin attenuates lupus nephritis by inhibiting neutrophil migration via PI3K/AKT/NF-kappaB signalling pathway. Lupus Sci Med 2024;11(2).

Download references

Acknowledgements

None.

Funding

The work was supported by National Natural Science Foundation of China (82203918), Natural Science Foundation of Jiangsu (BK20201082) and Jiangsu Innovative & Enterpreneurial Talent Programme (JSSCBS).

Author information

Authors and Affiliations

  1. Department of Dermatology, the First affiliated Hospital of Nanjing Medical University, Nanjing, China

    Chengzhong Zhang & Yan Lu

Authors
  1. Chengzhong Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Yan Lu
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

CZZ and YL performed the research, YL designed the research study and contributed essential reagents or tools, CZZ analysed the data and wrote the paper. All authors have read and approved the final manuscript.

Corresponding author

Correspondence to Yan Lu.

Ethics declarations

Ethical approval

All the experiments were ethically approved by the Animal Care and Use Committee and Human Ethics Committee of the First affiliated Hospital of Nanjing Medical University.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zhang, C., Lu, Y. MiR-223 within neutrophil axis promotes Th17 expansion by PI3K-AKT pathway in systemic lupus erythematosus. Arthritis Res Ther 27, 21 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13075-025-03487-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13075-025-03487-x

Keywords

Arthritis Research & Therapy

ISSN: 1478-6362

Contact us